Tau ASO-12 (murine) (sodium)

SKU HY-132582A-1 mg Category Tags ,

$450$1,850

Products Details

Product Description

– TauASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (TauASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ [1])

Web ID

– HY-132582A

Storage Temperature

– 4°C (Powder, sealed storage, away from moisture)

Shipping

– Room Temperature

Applications

– Neuroscience-Neurodegeneration

Molecular Formula

– N/A

References

– [1]DeVos SL, Miller RL, Schoch KM, et al. Tau reduction prevents neuronal loss and reverses pathological tau deposition and seeding in mice with tauopathy. Sci Transl Med. 2017;9(374):eaag0481. |[2]Laurence Mignon, et al. Design of the First-in-Human Study of IONIS-MAPTRx, a Tau-lowering Antisense Oligonucleotide, in Patients With Alzheimer Disease (S2.006). Neurology Apr 2018, 90 (15 Supplement) S2.006.|[3]Rationale for and Development of IONIS-MAPTRx, the First Tau-lowering Antisense Oligonucleotide, in Patients with Mild AD|[4]Methods for reducing tau expression. WO2023004390A1

Molecular Weight

– 7619

Compound Purity

– 94.68

SMILES

– [Tau ASO-12 (murine)]

Clinical Information

– No Development Reported

Solubility

– 10 mM in H2O

Target

– Tau Protein

Pathway

– Neuronal Signaling

Product type

– Oligonucleotides

Disclaimer: All products are for Research use only unless clearly stated otherwise on the product datasheet. Datasheets provided on the website are drafts for reference purpose only and you are requested to always refer to the hard copy included in the kit for your experimentation. Agdia Products are available for delivery only in Canada.

My Cart
Close Wishlist
Close Recently Viewed
Categories

Please fill out this form to request the file. We will send it to your Email address shortly. Thanks.

Please enable JavaScript in your browser to complete this form.

=

Please fill out this form to request the pricing.
We will send it to your email address shortly.
Thanks.

Please enable JavaScript in your browser to complete this form.

=