Download Files:
Tau ASO-12 (murine) (sodium)
$450 – $1,850
Products Details
Product Description
– TauASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (TauASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ [1])
Web ID
– HY-132582A
Storage Temperature
– 4°C (Powder, sealed storage, away from moisture)
Shipping
– Room Temperature
Applications
– Neuroscience-Neurodegeneration
Molecular Formula
– N/A
References
– [1]DeVos SL, Miller RL, Schoch KM, et al. Tau reduction prevents neuronal loss and reverses pathological tau deposition and seeding in mice with tauopathy. Sci Transl Med. 2017;9(374):eaag0481. |[2]Laurence Mignon, et al. Design of the First-in-Human Study of IONIS-MAPTRx, a Tau-lowering Antisense Oligonucleotide, in Patients With Alzheimer Disease (S2.006). Neurology Apr 2018, 90 (15 Supplement) S2.006.|[3]Rationale for and Development of IONIS-MAPTRx, the First Tau-lowering Antisense Oligonucleotide, in Patients with Mild AD|[4]Methods for reducing tau expression. WO2023004390A1
Molecular Weight
– 7619
Compound Purity
– 94.68
SMILES
– [Tau ASO-12 (murine)]
Clinical Information
– No Development Reported
Solubility
– 10 mM in H2O
Target
– Tau Protein
Pathway
– Neuronal Signaling
Product type
– Oligonucleotides
Disclaimer: All products are for Research use only unless clearly stated otherwise on the product datasheet. Datasheets provided on the website are drafts for reference purpose only and you are requested to always refer to the hard copy included in the kit for your experimentation. Agdia Products are available for delivery only in Canada.
