Download Files:
Inactive ASO (in vivo) sodium
$330 – $1,350
Products Details
Product Description
– Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide. ASO is a class of oligonucleotide molecules, usually composed of 20-30 bases, used to interfere with or regulate gene expression. Inactive ASO (in vivo) sodium is not targeted in the rodent genome and can be used as a negative control for Tofersen. Inactive ASO (in vivo) sodium contains thiophosphate skeleton modification and MOE modification. Cytosine in Inactive ASO (in vivo) is 5′ methylcytosine. See References for the location of chemical modifications
Web ID
– HY-153734
Storage Temperature
– -20°C (Powder, sealed storage, away from moisture)
Shipping
– Blue Ice
Molecular Formula
– N/A
References
– [1]McCampbell A, Cole T, Wegener AJ, et al. Antisense oligonucleotides extend survival and reverse decrement in muscle response in ALS models. J Clin Invest. 2018;128(8):3558-3567.
Molecular Weight
– N/A
Compound Purity
– 92.18
SMILES
– [CCTATAGGACTATCCAGGAA]
Clinical Information
– No Development Reported
Research Area
– Others
Solubility
– 10 mM in H2O
Target
– Others
Pathway
– Others
Product type
– Oligonucleotides
Disclaimer: All products are for Research use only unless clearly stated otherwise on the product datasheet. Datasheets provided on the website are drafts for reference purpose only and you are requested to always refer to the hard copy included in the kit for your experimentation. Agdia Products are available for delivery only in Canada.
