Download Files:

Bepirovirsen

SKU HY-147217-1 mg Category Tags , ,

$350$1,600

Products Details

Product Description

– Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1].

Web ID

– HY-147217

Storage Temperature

– -20°C (Powder, sealed storage, away from moisture)

Shipping

– Blue Ice

Applications

– COVID-19-anti-virus

Molecular Formula

– C230H309N88O115P19S19

References

– [1]Yuen MF, et al. Safety, tolerability and antiviral activity of the antisense oligonucleotide bepirovirsen in patients with chronic hepatitis B: a phase 2 randomized controlled trial. Nat Med. 2021 Oct;27(10):1725-1734.

CAS Number

– 1403787-62-1

Molecular Weight

– 7344.00

Compound Purity

– 93.92

SMILES

– [Bepirovirsen]

Clinical Information

– Phase 3

Research Area

– Infection

Solubility

– H2O : ≥ 20 mg/mL

Target

– HBV

Pathway

– Anti-infection

Product type

– Oligonucleotides

Disclaimer: All products are for research use only unless clearly stated otherwise on the product datasheet. Datasheets provided on the website are drafts for reference purpose only and you are requested to always refer to the hard copy included in the kit for your experimentation.

My Cart
Close Wishlist
Close Recently Viewed
Categories

Please fill out this form to request the file. We will send it to your Email address shortly. Thanks.

Please enable JavaScript in your browser to complete this form.

Please fill out this form to request the pricing.
We will send it to your email address shortly.
Thanks.

Please enable JavaScript in your browser to complete this form.