Bepirovirsen

SKU HY-147217-1 mg Category Tags , ,

$350$1,600

Products Details

Product Description

– Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1].

Web ID

– HY-147217

Storage Temperature

– -20°C (Powder, sealed storage, away from moisture)

Shipping

– Blue Ice

Applications

– COVID-19-anti-virus

Molecular Formula

– C230H309N88O115P19S19

References

– [1]Yuen MF, et al. Safety, tolerability and antiviral activity of the antisense oligonucleotide bepirovirsen in patients with chronic hepatitis B: a phase 2 randomized controlled trial. Nat Med. 2021 Oct;27(10):1725-1734.

CAS Number

– 1403787-62-1

Molecular Weight

– 7344.00

Compound Purity

– 93.92

SMILES

– [Bepirovirsen]

Clinical Information

– Phase 3

Research Area

– Infection

Solubility

– H2O : ≥ 20 mg/mL

Target

– HBV

Pathway

– Anti-infection

Product type

– Oligonucleotides

Disclaimer: All products are for Research use only unless clearly stated otherwise on the product datasheet. Datasheets provided on the website are drafts for reference purpose only and you are requested to always refer to the hard copy included in the kit for your experimentation. Agdia Products are available for delivery only in Canada.

My Cart
Close Wishlist
Close Recently Viewed
Categories

Please fill out this form to request the file. We will send it to your Email address shortly. Thanks.

Please enable JavaScript in your browser to complete this form.

  • United States+1
  • United Kingdom+44
  • Afghanistan+93
  • Albania+355
  • Algeria+213
  • American Samoa+1
  • Andorra+376
  • Angola+244
  • Anguilla+1
  • Antigua & Barbuda+1
  • Argentina+54
  • Armenia+374
  • Aruba+297
  • Ascension Island+247
  • Australia+61
  • Austria+43
  • Azerbaijan+994
  • Bahamas+1
  • Bahrain+973
  • Bangladesh+880
  • Barbados+1
  • Belarus+375
  • Belgium+32
  • Belize+501
  • Benin+229
  • Bermuda+1
  • Bhutan+975
  • Bolivia+591
  • Bosnia & Herzegovina+387
  • Botswana+267
  • Brazil+55
  • British Indian Ocean Territory+246
  • British Virgin Islands+1
  • Brunei+673
  • Bulgaria+359
  • Burkina Faso+226
  • Burundi+257
  • Cambodia+855
  • Cameroon+237
  • Canada+1
  • Cape Verde+238
  • Caribbean Netherlands+599
  • Cayman Islands+1
  • Central African Republic+236
  • Chad+235
  • Chile+56
  • China+86
  • Christmas Island+61
  • Cocos (Keeling) Islands+61
  • Colombia+57
  • Comoros+269
  • Congo - Brazzaville+242
  • Congo - Kinshasa+243
  • Cook Islands+682
  • Costa Rica+506
  • Croatia+385
  • Cuba+53
  • Curaçao+599
  • Cyprus+357
  • Czech Republic+420
  • Côte d’Ivoire+225
  • Denmark+45
  • Djibouti+253
  • Dominica+1
  • Dominican Republic+1
  • Ecuador+593
  • Egypt+20
  • El Salvador+503
  • Equatorial Guinea+240
  • Eritrea+291
  • Estonia+372
  • Eswatini+268
  • Ethiopia+251
  • Falkland Islands+500
  • Faroe Islands+298
  • Fiji+679
  • Finland+358
  • France+33
  • French Guiana+594
  • French Polynesia+689
  • Gabon+241
  • Gambia+220
  • Georgia+995
  • Germany+49
  • Ghana+233
  • Gibraltar+350
  • Greece+30
  • Greenland+299
  • Grenada+1
  • Guadeloupe+590
  • Guam+1
  • Guatemala+502
  • Guernsey+44
  • Guinea+224
  • Guinea-Bissau+245
  • Guyana+592
  • Haiti+509
  • Honduras+504
  • Hong Kong+852
  • Hungary+36
  • Iceland+354
  • India+91
  • Indonesia+62
  • Iran+98
  • Iraq+964
  • Ireland+353
  • Isle of Man+44
  • Israel+972
  • Italy+39
  • Jamaica+1
  • Japan+81
  • Jersey+44
  • Jordan+962
  • Kazakhstan+7
  • Kenya+254
  • Kiribati+686
  • Kosovo+383
  • Kuwait+965
  • Kyrgyzstan+996
  • Laos+856
  • Latvia+371
  • Lebanon+961
  • Lesotho+266
  • Liberia+231
  • Libya+218
  • Liechtenstein+423
  • Lithuania+370
  • Luxembourg+352
  • Macau+853
  • Madagascar+261
  • Malawi+265
  • Malaysia+60
  • Maldives+960
  • Mali+223
  • Malta+356
  • Marshall Islands+692
  • Martinique+596
  • Mauritania+222
  • Mauritius+230
  • Mayotte+262
  • Mexico+52
  • Micronesia+691
  • Moldova+373
  • Monaco+377
  • Mongolia+976
  • Montenegro+382
  • Montserrat+1
  • Morocco+212
  • Mozambique+258
  • Myanmar (Burma)+95
  • Namibia+264
  • Nauru+674
  • Nepal+977
  • Netherlands+31
  • New Caledonia+687
  • New Zealand+64
  • Nicaragua+505
  • Niger+227
  • Nigeria+234
  • Niue+683
  • Norfolk Island+672
  • North Korea+850
  • North Macedonia+389
  • Northern Mariana Islands+1
  • Norway+47
  • Oman+968
  • Pakistan+92
  • Palau+680
  • Palestine+970
  • Panama+507
  • Papua New Guinea+675
  • Paraguay+595
  • Peru+51
  • Philippines+63
  • Poland+48
  • Portugal+351
  • Puerto Rico+1
  • Qatar+974
  • Romania+40
  • Russia+7
  • Rwanda+250
  • Réunion+262
  • Samoa+685
  • San Marino+378
  • Saudi Arabia+966
  • Senegal+221
  • Serbia+381
  • Seychelles+248
  • Sierra Leone+232
  • Singapore+65
  • Sint Maarten+1
  • Slovakia+421
  • Slovenia+386
  • Solomon Islands+677
  • Somalia+252
  • South Africa+27
  • South Korea+82
  • South Sudan+211
  • Spain+34
  • Sri Lanka+94
  • St Barthélemy+590
  • St Helena+290
  • St Kitts & Nevis+1
  • St Lucia+1
  • St Martin+590
  • St Pierre & Miquelon+508
  • St Vincent & Grenadines+1
  • Sudan+249
  • Suriname+597
  • Svalbard & Jan Mayen+47
  • Sweden+46
  • Switzerland+41
  • Syria+963
  • São Tomé & Príncipe+239
  • Taiwan+886
  • Tajikistan+992
  • Tanzania+255
  • Thailand+66
  • Timor-Leste+670
  • Togo+228
  • Tokelau+690
  • Tonga+676
  • Trinidad & Tobago+1
  • Tunisia+216
  • Turkey+90
  • Turkmenistan+993
  • Turks & Caicos Islands+1
  • Tuvalu+688
  • US Virgin Islands+1
  • Uganda+256
  • Ukraine+380
  • United Arab Emirates+971
  • United Kingdom+44
  • United States+1
  • Uruguay+598
  • Uzbekistan+998
  • Vanuatu+678
  • Vatican City+39
  • Venezuela+58
  • Vietnam+84
  • Wallis & Futuna+681
  • Western Sahara+212
  • Yemen+967
  • Zambia+260
  • Zimbabwe+263
  • Åland Islands+358
5 + 4 =

Please fill out this form to request the pricing.
We will send it to your email address shortly.
Thanks.

Please enable JavaScript in your browser to complete this form.

  • United States+1
  • United Kingdom+44
  • Afghanistan+93
  • Albania+355
  • Algeria+213
  • American Samoa+1
  • Andorra+376
  • Angola+244
  • Anguilla+1
  • Antigua & Barbuda+1
  • Argentina+54
  • Armenia+374
  • Aruba+297
  • Ascension Island+247
  • Australia+61
  • Austria+43
  • Azerbaijan+994
  • Bahamas+1
  • Bahrain+973
  • Bangladesh+880
  • Barbados+1
  • Belarus+375
  • Belgium+32
  • Belize+501
  • Benin+229
  • Bermuda+1
  • Bhutan+975
  • Bolivia+591
  • Bosnia & Herzegovina+387
  • Botswana+267
  • Brazil+55
  • British Indian Ocean Territory+246
  • British Virgin Islands+1
  • Brunei+673
  • Bulgaria+359
  • Burkina Faso+226
  • Burundi+257
  • Cambodia+855
  • Cameroon+237
  • Canada+1
  • Cape Verde+238
  • Caribbean Netherlands+599
  • Cayman Islands+1
  • Central African Republic+236
  • Chad+235
  • Chile+56
  • China+86
  • Christmas Island+61
  • Cocos (Keeling) Islands+61
  • Colombia+57
  • Comoros+269
  • Congo - Brazzaville+242
  • Congo - Kinshasa+243
  • Cook Islands+682
  • Costa Rica+506
  • Croatia+385
  • Cuba+53
  • Curaçao+599
  • Cyprus+357
  • Czech Republic+420
  • Côte d’Ivoire+225
  • Denmark+45
  • Djibouti+253
  • Dominica+1
  • Dominican Republic+1
  • Ecuador+593
  • Egypt+20
  • El Salvador+503
  • Equatorial Guinea+240
  • Eritrea+291
  • Estonia+372
  • Eswatini+268
  • Ethiopia+251
  • Falkland Islands+500
  • Faroe Islands+298
  • Fiji+679
  • Finland+358
  • France+33
  • French Guiana+594
  • French Polynesia+689
  • Gabon+241
  • Gambia+220
  • Georgia+995
  • Germany+49
  • Ghana+233
  • Gibraltar+350
  • Greece+30
  • Greenland+299
  • Grenada+1
  • Guadeloupe+590
  • Guam+1
  • Guatemala+502
  • Guernsey+44
  • Guinea+224
  • Guinea-Bissau+245
  • Guyana+592
  • Haiti+509
  • Honduras+504
  • Hong Kong+852
  • Hungary+36
  • Iceland+354
  • India+91
  • Indonesia+62
  • Iran+98
  • Iraq+964
  • Ireland+353
  • Isle of Man+44
  • Israel+972
  • Italy+39
  • Jamaica+1
  • Japan+81
  • Jersey+44
  • Jordan+962
  • Kazakhstan+7
  • Kenya+254
  • Kiribati+686
  • Kosovo+383
  • Kuwait+965
  • Kyrgyzstan+996
  • Laos+856
  • Latvia+371
  • Lebanon+961
  • Lesotho+266
  • Liberia+231
  • Libya+218
  • Liechtenstein+423
  • Lithuania+370
  • Luxembourg+352
  • Macau+853
  • Madagascar+261
  • Malawi+265
  • Malaysia+60
  • Maldives+960
  • Mali+223
  • Malta+356
  • Marshall Islands+692
  • Martinique+596
  • Mauritania+222
  • Mauritius+230
  • Mayotte+262
  • Mexico+52
  • Micronesia+691
  • Moldova+373
  • Monaco+377
  • Mongolia+976
  • Montenegro+382
  • Montserrat+1
  • Morocco+212
  • Mozambique+258
  • Myanmar (Burma)+95
  • Namibia+264
  • Nauru+674
  • Nepal+977
  • Netherlands+31
  • New Caledonia+687
  • New Zealand+64
  • Nicaragua+505
  • Niger+227
  • Nigeria+234
  • Niue+683
  • Norfolk Island+672
  • North Korea+850
  • North Macedonia+389
  • Northern Mariana Islands+1
  • Norway+47
  • Oman+968
  • Pakistan+92
  • Palau+680
  • Palestine+970
  • Panama+507
  • Papua New Guinea+675
  • Paraguay+595
  • Peru+51
  • Philippines+63
  • Poland+48
  • Portugal+351
  • Puerto Rico+1
  • Qatar+974
  • Romania+40
  • Russia+7
  • Rwanda+250
  • Réunion+262
  • Samoa+685
  • San Marino+378
  • Saudi Arabia+966
  • Senegal+221
  • Serbia+381
  • Seychelles+248
  • Sierra Leone+232
  • Singapore+65
  • Sint Maarten+1
  • Slovakia+421
  • Slovenia+386
  • Solomon Islands+677
  • Somalia+252
  • South Africa+27
  • South Korea+82
  • South Sudan+211
  • Spain+34
  • Sri Lanka+94
  • St Barthélemy+590
  • St Helena+290
  • St Kitts & Nevis+1
  • St Lucia+1
  • St Martin+590
  • St Pierre & Miquelon+508
  • St Vincent & Grenadines+1
  • Sudan+249
  • Suriname+597
  • Svalbard & Jan Mayen+47
  • Sweden+46
  • Switzerland+41
  • Syria+963
  • São Tomé & Príncipe+239
  • Taiwan+886
  • Tajikistan+992
  • Tanzania+255
  • Thailand+66
  • Timor-Leste+670
  • Togo+228
  • Tokelau+690
  • Tonga+676
  • Trinidad & Tobago+1
  • Tunisia+216
  • Turkey+90
  • Turkmenistan+993
  • Turks & Caicos Islands+1
  • Tuvalu+688
  • US Virgin Islands+1
  • Uganda+256
  • Ukraine+380
  • United Arab Emirates+971
  • United Kingdom+44
  • United States+1
  • Uruguay+598
  • Uzbekistan+998
  • Vanuatu+678
  • Vatican City+39
  • Venezuela+58
  • Vietnam+84
  • Wallis & Futuna+681
  • Western Sahara+212
  • Yemen+967
  • Zambia+260
  • Zimbabwe+263
  • Åland Islands+358
12 * 5 =